Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC227
Clone ID YTC227
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC227
Sequence
AGCAGCAGCAGCAGCAGCAGCAGCAGAAGCAGCCACAGCAGCCTCTGCTACAGATGGATGCCAGAGAGAAGCAGGGACCA
CAGACGAGAGAATCACAGTTCCTGTATGCCTCAAAACTAGGCACGCAGCCTGCTCTCCTTTCCATCACACCCGGGAGACC
TTCTGGTAGTTCTGTTCTGGGTCCCTTAGCCAGAGTTCCACCAGCCACACCGGTGGCTCGAATGTCTGAGCAGAGCAACG
TGAACTCCGAGCCTGAGGAGGAGGAAGGAGGCCTGGAAGATGAAGATGGAGATGATGATGTTGCAGAGGTGGCTGAAAAA
GAGGCCCAGGCTGCTTCCAAATATTTCCACATGCAAAAAGTAACTCGCCAAGAACCCAGAGCAACACCCATGTCCAGCCT
GCTTCCAGTACCCGGACTTTCACCAAAGGGACAACAAACTAAAGAAGACCATACCAAAGATGCTTCCAAGGCCCCGCCCT
CTGTGCCCACAGCTGGACAGCCGAGCTGGAGTCTGGATGAGCAGCTTAAGCAGAATGGTGCTTTGGCCTGGAGTGACGAT
GCTGATGGAGGCAGGGGAAGAGAGATCTCTCGAGATTTTGCCAAGCTGTATGAACTAGACGGTGATCCTGAAAGGAAAGA
ATTTCTGGATGACCTCTTCATCTTCATGCAGAAGAG
Sequence Type mRNA
Unitrap ID UNI5164

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57657974..57681955 531
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004661 (Arid3b) NM_019689 AT rich interactive domain 3B (BRIGHT-like) Gene [Source:MGI Symbol;Acc:MGI:1930768]

 
Come back to gene ENSMUSG00000004661


For any suggestions or comments, please send an email to unitrap@crg.es