Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST270107
Clone ID OST270107
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST270107
Sequence
ACTGAGATCCAAAGGTAATTTTGGCTCTTGGTGATTATATGGGAGCAACTTGTCATGCTTGCATTGGAGGAACAAATGTT
CGAAATGAAATGCAGAAGTTGCAGGCTGAAGCCCCTCACATTGTTGTTGGTACTCCAGGGAGAGTGTTTGATATGCTAAA
CAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTCGTTTTGGACGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGG
ATCAGATCTATGAGATTTTCCAGAAATTAAATACAAGCATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTG
CTAGAAGTGACCAAGAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGAATTAA
ACAATTTTATATTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22481875..23110783 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022884 (Eif4a2) NM_013506 eukaryotic translation initiation factor 4B Gene [Source:MGI (curated);Acc:Eif4a2-002]

 
Come back to gene ENSMUSG00000022884


For any suggestions or comments, please send an email to unitrap@crg.es