Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST269426
Clone ID OST269426
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST269426
Sequence
TCAAGCGAGAGGGGCTCATGGAGCTGTGAGCCTTTGCTACTTCAAGTACCAGGTCCTGGCCGATCAGCACCAAGAATCCA
CTTGCAGNGGCAGGCCATCTNCCTGACCTGTCATCGAGAAGGTCCAGATTGCTGCCTATCGNCCTGGGATCGCTGTTCCT
CGTCGCCAGCATCTCCTGGCTCATCTGGTCCTCGCTCAGCCCTTCAGCCAAGTGGCAGCAGCCAGGACCTCCTCTTCCAG
ATTTGCTATGGCATGTACGGCTTCATGGATGTCGTCTGCATAGGCCTCATCGTCCACGAAGGGTCTTCTGTTTACCGCAT
CTTCAAGCGCTGGCAGGCCGTGAACCAGCAGTGGAAAGTCCTGAACTATGACAAGACCAAGGACGTGGGAGGAGACACAG
GGGGAGGGGCGGCAGGGAAGCCAGGCCCCAGGACCTCACGGTAGCCGT
Sequence Type mRNA
Unitrap ID UNI23248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126493810..126495356 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040502 (March9) NM_001033262 membrane-associated ring finger (C3HC4) 9 Gene [Source:MGI (curated);Acc:March9-001]

 
Come back to gene ENSMUSG00000040502


For any suggestions or comments, please send an email to unitrap@crg.es