Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC121
Clone ID YTC121
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC121
Sequence
TCCTCCACCTCCTGGTCAGGTTCTGCCACCTCCTCTAGCAGGACCTCTTAACCGAGGAGACCGCCCTCCACCACCAGTTC
TTTTTCCTGGACAACCTTTTGGGCAGCCTCCGCTGGGTCCACTTCCTCCTGGGCCTCCACCTCCAGTTCCAGGCTACGGC
CCCCCTCCAGGTCCACCGCCTCCACAGCAGGGACCACCTCCACCTCCAGGCCCCTTTCCACCTCGCCCACCAGGTCCACT
AGGGCCTCCCCTCACACTTGCTCCTCCTCCACATCTTCCGGGACCACCTCCAGGTGCCCCGCCACCAGCTCCACATGTGA
ATCCTGCTTTTTTTCCTCCACCAACTAATAGTGGCATGCCAACATCAGATAGTCGAGGTCCACCACCAACAGACCCATAT
GGCCGACCTCCCCCATATGATAGGGGTGACTACGGTCCCCCTGGG
Sequence Type mRNA
Unitrap ID UNI5182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 116797914..116798358 443
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055531 (Cpsf6) NM_001013391 cleavage and polyadenylation specific factor 6 Gene [Source:MGI Symbol;Acc:MGI:1913948]

 
Come back to gene ENSMUSG00000055531


For any suggestions or comments, please send an email to unitrap@crg.es