Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST268419
Clone ID OST268419
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST268419
Sequence
AACTCTGGACAATTCTACCTTGGGAGGTCAGCTCTTAGAGAATTGAATCAGATTGAGGCGGAACTGAATAAATATTGGCA
GCGGTTGTTAGAAGGGCTTTCTTACTACAAACCTCCCAGTCCAAGTTCAGCTGAAAGAGTGAAAGCTAATAAAGACGTAG
CGTCACCTCTGAAGGAGCTGGGCCTAAGAGTCAGCAAGTTCTTGGGTCTTGATGAAGAGCAGAGTGTGCAGTTACTGCAG
TGTTACCTTCAGGAGGATTACAGGGGTACNTCGGGACTCACTAAAGACAGTCCTGCNAGATGAGAGGCAGAGCCAGGCCT
TAACCCTGAAGGGGCCTTCGNTGGGTTCCTGGCACCCGTGGCAGCTCAGGAATGCCTTACCTCTGGCTNCAGATCCCTTC
TTGCCCTTCTTNTTTCTGGCCTTGGTAGGCACCTGTNCACATGTGNTNTACACAAACAAAAATAAA
Sequence Type mRNA
Unitrap ID UNI19466

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30153935..30159313 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052533 (Nup188) NM_198304 nucleoporin 188 Gene [Source:MGI (curated);Acc:Nup188-001]

 
Come back to gene ENSMUSG00000052533


For any suggestions or comments, please send an email to unitrap@crg.es