Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC155
Clone ID YTC155
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC155
Sequence
CGCGGCTATGGAGGGCGCAAAGTGTGCAGACGCCAATTTACTCACTGACACCGGAACAGAGTCCAGCCCCCGAAGTCCAG
TCTGCAGTCTCCGGCACTTTGCTTGTGAGCAAAACATGCTGTCCCGGCCGGATGGATCTGCTTCTTTTCTTCA
Sequence Type mRNA
Unitrap ID UNI3462

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26444249..26444400 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061286 (Exosc5) NM_138586 exosome component 5 Gene [Source:MGI Symbol;Acc:MGI:107889]

 
Come back to gene ENSMUSG00000061286


For any suggestions or comments, please send an email to unitrap@crg.es