Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC158
Clone ID YTC158
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC158
Sequence
CACGAATGCCACAAACTTCCAGTCACTTCGGCCTTTGCCATCCATTCAGATATTGGTGGATAAAATTAATTTGGAACATT
CTGTCCCAATGTATGATGAACAGTTGGTCCATGTAGTCAGCAGCCTTAATCAACCTTCTGATAATCTTCTTCATTATTGT
TATGTCCACTGCTACCTTAAGGTGTTTGGTTTTCAGGCCGGATTGACTTGCTTGGATCATAGTGGCTCTTACTGCTTACC
TGCACCAATTATCCCCTCTTTCAGCACAGCCCTTTATGGGAAGCTTCTGAAACTCCCTGCTCTCTGGACCAAAAGATCTC
AGACTGTTGTAACTGAGGGTATTTTTGAGCTCCCAAATCTCACAATTCAAGCTACAAGAGCACAGACACTTTTGTTGCAA
GCAATATATCAGAGTTGGTCTCATATTGGAAATGTCAGCTCTTCAACAGTAAATGAAGCTTTGATGAATGAAGTCTTCCC
AATGA
Sequence Type mRNA
Unitrap ID UNI2643

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 35384726..35401816 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037646 (Vps13b) vacuolar protein sorting 13B (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916380]

 
Come back to gene ENSMUSG00000037646


For any suggestions or comments, please send an email to unitrap@crg.es