Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST266601
Clone ID OST266601
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST266601
Sequence
TGAGCTCCTGTATGACAGCCCCAAGGCCCGGCAGGAGGTGGACCACCACTGGCAGGCGTCAGGCGGCCCCCACATCGTGC
GCATCCTGGACGTGTATGAGAATATGCACCACGGCAAGCGCTGTCTCCTCATCGTCATGGAATGCATGGAGGGTGGTGAG
CTGTTCAGCAGGATTCAGGAGCGTGGTGACCAGGCTTTCACTGAGAGAGAGGCTGCAGAGATAATGCGGGACATTGGCAC
TGCCATCCAGTTCTTGCACAGCCGGAACATTGCCCACCGAGATGTCAAGCCTGAAAACCTACTCTATACATCCAAGGAGA
AGGATGCTGTACTTAAACTCACCGATTTTGGCTTTGCCAAGGAAACCACCCAAAATGCCCTCCAGACACCCTGCTACACT
CCCTATTATGTGGCTCCTGAGGTCCTGGGTCCAGAGAAGTATGACAAGTCCTGTGATATGTGGTCCCTGGGCGTCATCAT
GTACATCCTT
Sequence Type mRNA
Unitrap ID UNI20771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107161145..107166097 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032577 (Mapkapk3) NM_178907 mitogen-activated protein kinase-activated protein kinase 3 Gene [Source:MGI (curated);Acc:Mapkapk3-001]

 
Come back to gene ENSMUSG00000032577


For any suggestions or comments, please send an email to unitrap@crg.es