Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DD0495
Clone ID DD0495
Vector pGT1lxrT2
Project sanger

Sequence tag DD0495
Sequence
GATCCGGATGACAGCAGGCATTAAGGGCTGGCTACTGGACTGAAGCTGCTGGAAACTT
Sequence Type mRNA
Unitrap ID UNI433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 160513510..160513567 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040749 (Siah1b) NM_009173 seven in absentia 1B Gene [Source:MGI (curated);Acc:Siah1b-002]

 
Come back to gene ENSMUSG00000040749


For any suggestions or comments, please send an email to unitrap@crg.es