Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST266506
Clone ID OST266506
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST266506
Sequence
ATGAGGTGGCTGGCGACATCTTTGACATGCTGCTCACATTCACGGATTTTCTGGCTTTCAAGGAGATGTTCCTGGACTAC
AGAGCAGAAAAGGAAGGCCGAGGACTGGACTTAAGCAGCGGCTTGGTTGTGACTTCTCTGTGTAAGTCATCTTCTACACC
AGCTTCCCAGAACAACCTGCGGCACTAGGTCCCACCTTCGCACAACCGGTGTGATTGACATGAGTTCACCAGACCAGCAG
GCTCCGA
Sequence Type mRNA
Unitrap ID UNI23295

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97195973..97197077 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031776 (Arl2bp) NM_024269 ADP-ribosylation factor-like 2 binding protein Gene [Source:MGI Symbol;Acc:MGI:1349429]

 
Come back to gene ENSMUSG00000031776


For any suggestions or comments, please send an email to unitrap@crg.es