Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC066
Clone ID YTC066
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC066
Sequence
TCATCCCATGGCGGCCACCCTTTGGATGTCCCAGATCATGTCATTGCGTATCACCGCACAGCGATCCGGTCAGCGAGTGC
TTACTGTAGCCCTTCCTTGCAAGCAGAAATGCATATGGAGCAGTCGTTATACAGACAAAAGTCAAGGAAATACCCTGATA
GCCATTTGCCTACCTTGGGCTCCAAAACGCCCCCAGCCTCTCCACACCGTGTGGGTGACTTAAGAATGATAGACCTGCAC
CCGCATCTTAACACACATGGGCCCCCTCACACTCTGCAGCCAGACCGGGCCTCCCCCAGTCGCCAGTCCTTTAAAAAGGA
ACCCGGCACCCTGGTGTACATCGAAAAGCCACGAAACACTTCAGGATTATCCAGCCTTGTAGACCTGGGGCCTCCTCTAG
TTGAGAAGCAAGGTTTTGCTTACAGCACCACTACAATCCCCAAAGACAGAGAAACCAGTGAGAAAATGGTGAAAGCCACA
GCCAACAGGAACCAAGCAGATGGTG
Sequence Type mRNA
Unitrap ID UNI5224

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20665461..20681888 460
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es