Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST266011
Clone ID OST266011
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST266011
Sequence
TACTGCAAGTGCAAAAAATTTACAGACTTTGATGAAGACCGGCTGGAGATCATAANACAGACTGACCGGGTCACAGGCAC
CAACAAAGGCATCTCCCCTGTGCCCATCAACCTTCGGGTCTACNCACCACACGTGTTGAACTTGACCCTNATCGACCTCC
CAGGNATCACTAAGGTGCCGGTGGGGGACCAGCCGCCAGACATCGAGTACCAGATNAAGGACATGATCCTGCAGTTCATC
ANTCGCGAGAGCAGNCTCATTCTTGCCGNAACACCTGCCAACATGGACTTGGCCAACTCAGACGCCCTCAAGCTGGCCAA
GGAGGTGGACCCCCAAGGCCTACGGACCATCGGTGTNATNACCAAGCTAGACTTGANGGATGAAGGCACAGACGCCAGGN
ATGNCCTGGNAAACAAGCTACTGNCCTTGAGAAGAGGCTATATNGGCGTGGTTAACCGAAGCCAAAC
Sequence Type mRNA
Unitrap ID UNI5748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21270044..21277084 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es