Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA407
Clone ID YTA407
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA407
Sequence
CTGGCACCGGGCGGGGACTCGATGGCTGAGGACGCTCCTGTGTCCCCAGAATCCTTCAGAAGGCCAGCCGCCATGTCCAC
ATTCAGGCAAGAGGATGTTGAGGACCATTATGAGATGGGAGAGGAGCTTGGCAGTCACAGCACAGCTT
Sequence Type mRNA
Unitrap ID UNI5232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80645808..80646820 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034974 (Dapk3) NM_007828 death-associated protein kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1203520]

 
Come back to gene ENSMUSG00000034974


For any suggestions or comments, please send an email to unitrap@crg.es