Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST265351
Clone ID OST265351
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST265351
Sequence
GGAAGGAGTGAAGGCCAGCCTGAATGGTGAAACAAATCCACCCATTGAAGGGAACCAGGCAGGTGACACAGCTGCCTCTG
CAAGGAGTCTCCCAAATGAAGAAATAGTGCAGAAGATAGAGGAGGTCCTCTCTGGGGTCTTAGATACGGAGCTGCGGTAC
AAGCCCGACTTGAAAGAGGCCTCCAGAAAAAGTAGATGCNGTATCTGTGCAAACAGATCCTACTGATGAAGTGCCCACCA
AAAAGTCAAAGAAGCATAAAAAGCACAAAAACAAAAA
Sequence Type mRNA
Unitrap ID UNI17198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91651876..91654964 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022961 (Son) NM_019973 Son DNA binding protein Gene [Source:MGI (curated);Acc:Son-001]

 
Come back to gene ENSMUSG00000022961


For any suggestions or comments, please send an email to unitrap@crg.es