Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST265346
Clone ID OST265346
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST265346
Sequence
AACTGAGGTGATACCTCTGTCCTGGCTGGAGTCTATGGGCCGGCCGAGGTGAAGGTCAGCAAAGAAATCTTCAACAAGGC
CACCCTTGAAGTGATCCTGAGGCCGAAGATCGGGCTGCCTGGCGTGGCCGAGAAGAGCCGCGAGCGGCTGGTCAGGAATA
CCTGTGAAGCTGTGGTTCTAGGGGCCCTGCACCCCCGGACCTCAATCACCGTGGTGCTGCAGGTGGTGAGCGACGCTGGC
TCTCTCTTGGCCTGTTGCTTGAACGCTGCTTGCATGGCATTGGTGGATGCAGGTGTGCCCATGCGAGCCCTCTTCTGTGG
GGTCACCTGTGCCCTGGACTCTGATGGAAATCTCGTGCTGGACCCCACAACCAAGCAAGAAAAGGAGGCCCGGGCCATCC
TGACCTTTGCTCTGGATAGCGCCGAGCAGAAGCTGCTCATGTCCACCACCAAGGGGCTCTATTCTGACGCTGAGCTCCAA
CAGTGTCTGGCCGCCGCCCAAGCCGCCTCACAGCACATCTTCCGATTCTACCGGGAATCACTT
Sequence Type mRNA
Unitrap ID UNI3462

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26448154..26452786 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061286 (Exosc5) NM_138586 exosome component 5 Gene [Source:MGI Symbol;Acc:MGI:107889]

 
Come back to gene ENSMUSG00000061286


For any suggestions or comments, please send an email to unitrap@crg.es