Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST264782
Clone ID OST264782
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST264782
Sequence
GAACTGAGGTAACCTGGATGGAGAAGACATGCTGCAGAGAGAACCCTGGAGGATGTTTTCCTTCGAAAGTTTATGATGGG
CACCTTTCCCGGCTGCCTGGCTGACCAGATTGTTCTGAAGCGCCGGGCCAACCAAGTGGACATCTGTGCCCTGGTCCTCA
GGCAGCTGCCAGCACACAAATTCTACTTCCTCGTGGGCCTACAGTGAGACTCTGTTGTCACACTTTTACAAGTGTCCTGT
GCCGACTCCACCTGCAAACNTGTGCCCTCCAAGGGTCGTGTACAAGTACATATAAAAAGTGCACTTTTCTCCAGTAGAGC
CCTACAAGGTCACAAANGGTGCAAGGAGACCAAAATGCCTGNTCTCTGNAGGTGGAAGCGTCANCTCCAAAGCTGCTGTT
TGAAAAAAACCCTGGATCATGTTTT
Sequence Type mRNA
Unitrap ID UNI13766

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5604383..5604737 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020477 (Mrps24) NM_026080 mitochondrial ribosomal protein S24 Gene [Source:MGI (curated);Acc:Mrps24-001]

 
Come back to gene ENSMUSG00000020477


For any suggestions or comments, please send an email to unitrap@crg.es