Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST264586
Clone ID OST264586
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST264586
Sequence
GCTCCTGAGTCTTTGAGGAACACAGCCTCCTGGTGGAAGTTCGTGGCACCTGTGACGAGGTCACCTGCCAGCAGATGACC
GAGACCAGCCCTTAGTCCTAGGTGTGGTCAAGAGTGTCTTGGGCTCCAAAGCCTACCTGGACCCTACCACCATGTCAGGA
TCCACACAGCCTGTGGCACAGACATGGCGGGCTGCTGAGCCCCGCTACCCACCCCCTTCCTTGGGCAAAATGGACTTGAT
GCGTATTCTGTGGCCGCTCTCTGTGCACGGCGGCATTCTGTCATTTACACATGTTGTTCCAATTAAAAAGCAAATATACT
CAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125497536..125634021 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029478 (Ncor2) NM_011424 nuclear receptor co-repressor 2 Gene [Source:MGI (curated);Acc:Ncor2-002]

 
Come back to gene ENSMUSG00000029478


For any suggestions or comments, please send an email to unitrap@crg.es