Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST264569
Clone ID OST264569
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST264569
Sequence
GAGGTCTGCCAAATGTCTGAAAGATCAGATCTCCTTCACTTCAAGTTTGAAAATTATGGAGATTCAATGTTACAAAAAAT
GAACAAATTAAGAGAAGAGAATAAATTTTGTGATGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18574

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37292404..37292521 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050714 (Zbtb26) NM_199025 zinc finger and BTB domain containing 26 Gene [Source:MGI (curated);Acc:Zbtb26-001]

 
Come back to gene ENSMUSG00000050714


For any suggestions or comments, please send an email to unitrap@crg.es