Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST263495
Clone ID OST263495
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST263495
Sequence
GACTGAGACATGGATTCTGAATTATCACAGAGTATGGTTGGGAGCTATCTTAACCCTCCAGAAAGAATGCATCTTCCATC
ATTCACGCAAAATGAAGCATTTCAGAATTGCCACCCTGGGACCCCTCCTAAAATGTTTAATAGTCCAAACAACCAAGCAC
TTGNTTCANNATTAAAAANCTCGTCCNGGGACANGATTCTGTCAGACTCCGNGCGTGNANAGGACACAGGCTGANNACNA
CCTGNACCTTGNGNCNAGAGNAGNAGANCAGCATAAGAAGGCCCTAGNGGAGGNNACNNACNAGAGGAACCNNANNCACC
AGGAGCTGANTAANCANANGANAGGTGAAAGGACCGAGGTTCTCGGACATGTGGGGTGGNCAGAGTTTACAGNCTGAACA
GTNANCCCAGGGAGCTGNCTCAGCTGCCTNTGCTCTTCTGTCATAGAAACTGTGAGAAAC
Sequence Type mRNA
Unitrap ID UNI1113

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41462733..41465729 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019813 (2410017P07Rik) NM_026643 RIKEN cDNA 2410017P07 gene Gene [Source:MGI Symbol;Acc:MGI:1915511]

 
Come back to gene ENSMUSG00000019813


For any suggestions or comments, please send an email to unitrap@crg.es