Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA478
Clone ID YTA478
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA478
Sequence
GGCCGCCCGCGCGCCGAAGGCCTCCGGAAGAGGCGGCCGC
Sequence Type mRNA
Unitrap ID UNI5257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 131088512..131088551 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037514 (Pank2) NM_153501 pantothenate kinase 2 (Hallervorden-Spatz syndrome) Gene [Source:MGI (curated);Acc:Pank2-001]

 
Come back to gene ENSMUSG00000037514


For any suggestions or comments, please send an email to unitrap@crg.es