Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST263398
Clone ID OST263398
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST263398
Sequence
GAACTGAGTGATCCGGAGCATCTGAAAAAGGACTGGATGAGTTAGTCGGTGCCATTGAAGAACATTTTTTCCAGCCACAA
AAATATAACCTACAGCCAAAAGCAGAATAAAACATTCCAGTACTGGATAGGATTAAATTTACCTCCAATAAACTGAACTT
GATTGTTAAAGCAATAATATTTTAGGGCCAAGTGATTCAGATANCTCACCACAAGTATTTACATATTTTCAACAGCTCTA
TCTTCCTTGNGATTTTTTTTTTAATTATTATTATTTTTAGCCTGAAAAGNGAATAAAAAAGCTTGGCCAAACCCAACAAA
CTAANATNTNTATGAAAANGNTAAATCTGGGCATTATCTGAATTTTTTAAATAAAGATTTAATTTT
Sequence Type mRNA
Unitrap ID UNI23335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 64519014..64519393 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029171 (Pgm1) NM_025700 phosphoglucomutase 1 Gene [Source:MGI (curated);Acc:Pgm1-001]

 
Come back to gene ENSMUSG00000029171


For any suggestions or comments, please send an email to unitrap@crg.es