Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST263338
Clone ID OST263338
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST263338
Sequence
TACAAGCTAGTAGTCCTTGGTTCAGGAGGCGTGGGGAAGNCTGCTCTGACANTTCANTTTGTTCAGGGGATTTTTGTTGA
AAAATATGACCCAACGATAGAAGATTCCTACAGAAAGCNGGTNGNGGTAAGATTGCCAACAGTGCATGCGTGGAGATCCT
GGACACTGCAGGAACCCGAGCAATTTACAGCAATGAGGGATTTGTATATGAAGAATGGCCAAGGGTTTGCACTAGTTTAT
TCAATTACAGCTCANTCTACGTTTAATGATTTACAAGACTTGAGNAGAACAGATTTTACNGGGTTAAAGACACAGAAGAT
GTTCCAATGATTTTGGTTGGCAATAAATGTGACTTGGAAGATGAACGGGTANTTGGCAAAGAACAAGGCCAGAATTTACC
TAGACAGTGGTGTAACTGNGCCTTTTTAGAATCCTTCTGCAAAG
Sequence Type mRNA
Unitrap ID UNI19320

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 105540694..105553210 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068798 (Rap1a) NM_145541 RAS-related protein-1a Gene [Source:MGI Symbol;Acc:MGI:97852]

 
Come back to gene ENSMUSG00000068798


For any suggestions or comments, please send an email to unitrap@crg.es