Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST263162
Clone ID OST263162
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST263162
Sequence
GAACTGAGGAAGACTCTTCAAGAAATCACAATGTCAACCAACACAGACCTTTCTCTCTCTTCATACGATGAAGGTCAGGG
GTCTAAGTTTATTCGGAAAGCTAAGGAGACACCGTTTGTCCCCATTGGAATGGCGGGCTTTGCAGCGATTGTTGCCTATG
GGTTGTACAAGCCTGAAGAGCAGAGGAAATACAAAGATGTCCATTCACTTGATCCACATGCGTGTAGCAGCCCAGGGCTT
TGTTGTGGGGGCCATGACTCTTGGTATGGGCTACTCCATGTATCAGGAATTCTGGGCCAACCCTAAGCCTAAGCCTTANA
AGAGCTGGTGGCATGGGAAGTGCTTGCTTTAGTTAGACGTCTCATATTGAGGTTACGTGTTTGTATCTACAATAAATAAC
ATGTGGGTTTAGACAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23338

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121758653..121761729 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038412 (Higd1a) NM_019814 HIG1 domain family, member 1A Gene [Source:MGI Symbol;Acc:MGI:1930666]

 
Come back to gene ENSMUSG00000038412


For any suggestions or comments, please send an email to unitrap@crg.es