Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST263056
Clone ID OST263056
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST263056
Sequence
CCTGAGGGAAGACATGGGAGTGGGGGCGTAGCCTCCTCCTCTGAGAGCAACCGGGATCGGAGAGAGCGTCTGCGCCAATT
GGCCCTGGAAACCATTGACATCAACAAGGACCCGTATTTTATGAAGAACCACTTGGGATCCTATGAGTGCAAACTCTGCC
TGACCTCTGCATAANANTGAGGGGAGTTACCTGGCCCATACCCAACGGGAAGAAACATCAGACGTAACCTTGGCCCGGCG
AGCCTGCC
Sequence Type mRNA
Unitrap ID UNI10818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80264000..80265187 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020211 (Sf3a2) NP_038679 splicing factor 3a, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:104912]

 
Come back to gene ENSMUSG00000020211


For any suggestions or comments, please send an email to unitrap@crg.es