Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST262887
Clone ID OST262887
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST262887
Sequence
GACTGAGGTGAGTTGGAGTGAGCTAGATCAGAAAGATGACACTCCATGCCACCCGGGCAGCTACGCTCCTTTCTTGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCTGCACATCTGAACCTCAACTTCTTTACCTTTGAATTTC
CTATCCCAAGCAAATAACACCAGAATAAAACATTCTCACATTTATAAATCAATAAAAAGCAAAATTTTAACGTTGAAAAA
AAAAAA
Sequence Type mRNA
Unitrap ID UNI17422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109125892..109130569 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066306 (Numa1) NM_133947 nuclear mitotic apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443665]

 
Come back to gene ENSMUSG00000066306


For any suggestions or comments, please send an email to unitrap@crg.es