Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST262865
Clone ID OST262865
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST262865
Sequence
GAACTGAGAGTTTTCTTGGAGGCTTTTTTGGTCCCATTTGTGAGATTGATGTTGCCCTTAATGATGGGGAAACCAGGAAA
ATGGCAGAAATGAAAACTGAGGATGGCAAAGTAGAAAAACACTATCTCTTCTATGATGGCGAGTCTGTCTCAGGAAAGGT
AAACCTAGCCTTTAAGCAGCCTGGAAAGAGGCTAGAGCATCAAGGAATTAGAATTGAATTTGTAGGTCAAATTGAGCTTT
TCAATGACAAGAGTAATACTCATGAATTTGTAAACCTAGTGAAGGAACTAGCCTTGCCTGGAGAACTGACTCAGAGCAGA
AGCTATGACTTTGAATTTATGCAAGTTGAAAAGCCATATGAGTCATACATCGGTGCCAATGTCCGCCTGAGGTATTTTCT
TAAGGTGACAATTGTGAGAAGATTGACAGACTTAGTGAAAGAGTACGATCTTATTGTTCATCAGCTAGCCACCTATCCTG
ATGTCAACAACTCTATTAAAATGGAAGTGGGCATTGAAGACTGTCTGCACATAGAGTTTGAATATAATAAG
Sequence Type mRNA
Unitrap ID UNI22342

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61931043..61943457 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020078 (Vps26a) NM_133672 vacuolar protein sorting 26 homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:1353654]

 
Come back to gene ENSMUSG00000020078


For any suggestions or comments, please send an email to unitrap@crg.es