Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST262789
Clone ID OST262789
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST262789
Sequence
GACTGAGGATGTCACTGGAATCGTCTTCCCATCAGTGCCACCCTGCTTCCCTTCTGTGTTACCTTCAGTGCCTGATGACA
TTGCCAGCTCTTCCCCTCCTCCAATGTCTTACATCACTTCCCAGGAGATGAAGTGTATTCTTCACTGGTTTGCCAGTTGG
TCAGGTCCCCAGCGGGAACGTTTTCTACAGGACCTGGTCGCTAAGGCAGTGCCGGGAAAGCTACAGCCACTGCTGGATGC
TCTGGAGCAGCTTAGTATGTCTGCAGCAAATCGACCACCATGTATCTTTGAGTGTCAGCTACGTCTTTGGGATCAGTGGT
TTCGAGGTTGGGCTGAGCAGGAGCGCAATGAATTTGTCAGGCAGCTGGAAGTCAATGAGCCAGATTTCGTGGCAAAGTTT
TACCAAGCAGTGGCTGCTACTGCTGGTAAGGACTGACAGGCATTCAAATCAAGAAGAGAATGACATGTGATCACACCATG
ACTGTAGTGATGATTCAGTGCAAGTATGTCACTTAAAGATTCACCTGA
Sequence Type mRNA
Unitrap ID UNI18555

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55308639..55309162 506
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040822 (1700123O20Rik) NM_021437 RIKEN cDNA 1700123O20 gene Gene [Source:MGI Symbol;Acc:MGI:1920893]

 
Come back to gene ENSMUSG00000040822


For any suggestions or comments, please send an email to unitrap@crg.es