Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA541
Clone ID YTA541
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA541
Sequence
ACATCTTCACACACTGCTGGATCTGTATGACAAAATTAACACAAAGTCTTCGCCACAAATCAGGAATCCTCCAAGTGATG
CAGTACAGAGAGCCAAAGAGGTATTGGAAGAAATTTCATGTTACCCTGAGAATAATGATGCGAAGGAACTAAAGCGTATT
TTAACACAACCTCATTTCATGGCCTTACTTCAGACTCATGATGTAGTGGCACATGAAGTTTACAGTGATGAAGCATTAAG
GGTCACACCTCCCCCGACTTCCCCCTATTTAAACGGTGATTCTCCAGAAAGTGCAAACGGAGACATGGACATGGAGAATG
TGACCAGAGTTTTCCCCCCCCCACTCCCAGTA
Sequence Type mRNA
Unitrap ID UNI5268

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 13138680..13163991 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031012 (Cask) NM_009806 calcium/calmodulin-dependent serine protein kinase (MAGUK family) Gene [Source:MGI (curated);Acc:Cask-001]

 
Come back to gene ENSMUSG00000031012


For any suggestions or comments, please send an email to unitrap@crg.es