Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST262725
Clone ID OST262725
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST262725
Sequence
GTCGACTCTACAGTGCTCTCGCCAAGACCGTCAACAGCAGTGCAGCTGCTCAGCACCCGGAGTACTTGGTGTCAGCTGAC
CCCGAACATCTGGAGCCCATCGATCCTAAGGAACTTCTGGAGGAATGCAGGGCTGTTCTGCACACTCGGCCACCCCGCTA
CCAGCGGGATTTTGTGGACCTGAGGACAGATTGCTCCAGCAGCCACTCTCCCATTCGCGTCATGCAGTGGAACATCCTCG
CCCAAGCTCTCGGAGAAGGCAAAGACAACTTTGTGCAGTGCCCCGTGGAAGCGCTCAAATGGGAAGAGAGGAAGTGCCTG
ATCCTGGAGGAGATCCTGGCTTACCAGCCAGACATACTGTGCCTCCAGGAAGTGGACCACTACTTTGACACCTTCCAGCC
ACTNCTCAGTAGACTGGGCTACCAANGCACGTTTTTCCCCAAGCCCTGGTCACCATG
Sequence Type mRNA
Unitrap ID UNI2209

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51051751..51053829 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023087 (Ccrn4l) NM_009834 CCR4 carbon catabolite repression 4-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ccrn4l-001]

 
Come back to gene ENSMUSG00000023087


For any suggestions or comments, please send an email to unitrap@crg.es