Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST262548
Clone ID OST262548
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST262548
Sequence
TAGCCCGTGCACCCCCAGGGGAGTTTAATGAAGTATTCAATGATGTCCGGCTACTGCTTAACAATGACNATCTCCTCAGG
GAAGGGGCNGCACATGCATTTGCCCAGNATAACATGGATCANTTCACACCCGTGAAGATAGAANGCTACCGATGACCAGG
TAATGACTGCCTGTTNCACGGACTGTGCCGGGATCTAAANATGTAANAGCCANAACCCATAGGAAATTGGCTGNTAATAT
ATTTATGTCTTTGNTTTTTAAAATA
Sequence Type mRNA
Unitrap ID UNI7213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104643640..104647874 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070372 (Capza1) NM_009797 capping protein (actin filament) muscle Z-line, alpha 1 Gene [Source:MGI (curated);Acc:Capza1-001]

 
Come back to gene ENSMUSG00000070372


For any suggestions or comments, please send an email to unitrap@crg.es