Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST262436
Clone ID OST262436
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST262436
Sequence
AAACTGGTTGTACTTTNCCCTTGCTGTTCTTCAACCCCTCTCTTTGGCCCTTGNTTCCTCACCTGCTCTGGGACACCTAA
CTCAAGAGACCTCCCTTCTCCCCCTGCCGGCCCAATTATGGCAGAGAACGATGTGGACAATGAGCTCTTGGACTACGAAG
ACGACGAGGTGGAGACAGCCGCTGGGGCAGATGGGACCGAGGCTCCCGCCAAGAAAGACGTCAAGGGCTNCTACGTCTCC
ATCCACAGCTCCGGCTTCCGAGATTTTCTACTCAAGCCANAGCTGCTCCGGGCCATCGATGACTGTGGCTTTGAGCATCC
ATNANGAGGTCCAGTATGAGNGCATNCCGCAGGCCATTCNGGGGATGGATGTNCTGNGCCAGGCCAAGTCAGGCTTGGGT
AAAAAC
Sequence Type mRNA
Unitrap ID UNI18118

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35380070..35381155 305
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es