Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST262213
Clone ID OST262213
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST262213
Sequence
GACTGAGATATCTTTGGCGATTTCAGCCCTGAGAATTNAATCAGTTTTTTGTGACTCCCCGCTCTTNTGTTGAGCTCCCT
CCATACAGNGGGACTCTGTGTAGCATACAGGCTGANGATGAACTGCCAGATGCANGACAGGAGCACCAGAGGATCGAGTT
TGGTGTAGATGAAGTCATCGAACCTAGTGAGGGGCTGCCGCCAACTCCTAGCTACAGTATTTCAAGCACCTTGAACCCCC
AGACTCACTTNACCTGACTTCCTATGCCTTAGTGNGGAAGGNTTCTTGTTGCTTTTTACCACCAGGNANACTATTGGTCT
TGTGGGTCTTGACCAAAGATGCTAT
Sequence Type mRNA
Unitrap ID UNI10955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122455750..122465119 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]

 
Come back to gene ENSMUSG00000031826


For any suggestions or comments, please send an email to unitrap@crg.es