Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST262117
Clone ID OST262117
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST262117
Sequence
GACTGAGGTATTTGAATTTAGAGTTTAGTTTCCCATAACATTTTCTACAAGAAGAATCTTGGTAGTGTCTCAAAGACATC
ACTGACTTCTGGATCCTGCAGAAAGCCCAAGGTGAAAAGAAATGGGCCGCTCCAATTCTAGATCACATTCTTCAAGATCC
AAGTCTAGATCACAGTCTAGTTCTAGATCAAGATCAAGATCACATTCTAGAAAGAAGAGATACAGTTCTAGGTCTCGTTC
CAGAACATATTCGAGGTCTCGTAGTAGAGATCGTATTTATTCTAGAGATTATCGTCGAGATTACAGGAATAATAGAGGAA
TGAGACGACCTTATGGGTACAGAGGAAGGGGTAGAGGGTATTATCAAGGAGGAGGAGGGAGATACCATCGAGGTGGCTAT
AGACCTGTCTGGAATAGAAGGCACTCTAGGAGTCCTAGACGAGGTCGGTCACGGTCCAGGAGTCCAAAAAGAAGATCCGT
GTCTTCTT
Sequence Type mRNA
Unitrap ID UNI15623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20037809..20043030 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037608 (Bclaf1) NM_001025393 BCL2-associated transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1917580]

 
Come back to gene ENSMUSG00000037608


For any suggestions or comments, please send an email to unitrap@crg.es