Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTB011
Clone ID YTB011
Vector pGT0Lxf
Project baygenomics

Sequence tag YTB011
Sequence
GCTCATTTTGGAGACCTAGGCAGATCCTGTCTGGACTATCAGACTCAAGAGACCAAATCCAGTCTTTCAAAGACCCTTGA
ACAAGTCTTGCGTGACACTGTTGTCCTTCCATATTTCCTTCAGTTTATGGAACTTCGGAGAATGGAGCACCTGGTGAAAT
TTTGGTTAGAGGCTGAAAGTTTTCACTCTACAACGTGGTCCCGAATAAGAGCACACAGTCTAAACACAGTGAAACAGAGT
TCACTGGCTGAGCCTGTCTCTCCATCTAAAAGACATGAGACTCCAGCATCTTCTGTAACTGAGGCTCTTGACAGGAGGTT
GGGGGATTCTTGCTCAGCCCCACTGCTTGTGACTCAATCAGAAGGAACTGACCTGAGTAGTAGAACTCAGAACCCTCAGA
ACCACTTGCTGCTTTCCCAGGAAGGCCACAGTGCCCGTTCTCTCCATCGTGAGGTGGCCAGAACAGGAAGTCATCAGATT
CCCACCGACTCCCAGGACTCCTCCTCCAGACTTGCAGTAGGCAGTAGAAACAGTTGCTCTTCTCCACTGAGAGAACTGTC
AGAAAAACTAATGAAAA
Sequence Type mRNA
Unitrap ID UNI5285

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61728526..61729604 559
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047804 (Akap10) NM_019921 A kinase (PRKA) anchor protein 10 Gene [Source:MGI (curated);Acc:Akap10-001]

 
Come back to gene ENSMUSG00000047804


For any suggestions or comments, please send an email to unitrap@crg.es