Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST261970
Clone ID OST261970
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST261970
Sequence
GTTTCCCTGTGCTTTTNGNNGTNGTNTTGTTTNNGGGGTNCCCGTTCTTNATTTGCCTGCTCCAGGTTGAAGAAGCTTCT
AGATGGATCCTTTCCAAATTTGGTGTCTTTTCTACAAACTCTGTGCCTCAACCTCAATTTCTAANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCTGCCCGGCTTCACATTCCATTCTTTTTGCAGATAGATCATGGAAGGGAAGTGGTT
ACTGTGTTTGCTGCTGGTCCTTGGAACTGCAGCTGTTGAGGCTCATGATGGACATGATGATGACGCGATTGATATTGAAG
ATGATCTTGATGATGTTATTGAAGAGGTAGAAGATTCAAAATCTAAATCAGATGCCAGCACTCCTC
Sequence Type mRNA
Unitrap ID UNI6711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50125117..50125318 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]

 
Come back to gene ENSMUSG00000020368


For any suggestions or comments, please send an email to unitrap@crg.es