Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST261875
Clone ID OST261875
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST261875
Sequence
ACTGAGACATGGCCGTGCCTCCCCATACGCCGATCTTGGCAAGTCCGCCAGGGATGTCTTCACCAAGGGCTACGGCTTTG
GCTTAATAAAACTTGATTTGAAAACGAAGTCANAGAATGGATTGGAATTTACCAGCTCAGGCTCTGCCAACACGGAAACC
ACCAAAGTGAACGGCAGCCTGGAAACCAAGTACAGATGGACCTGAGTATGGGCCTGACGTTTACAGAGAAGTGGAACACA
GACAACACCCTGGGCACTGAGATCACTGTGGAAGACCAGCATTGCTCGTGGACTGAAGCTCACCTTTGATTCGTCATTCT
CGCCGAACACTGGGAAAAAAAATGCTAAAATCAAGACAGGGTACAAGAGGGAGCACATCAACCTCGGCTGTGACGTGGAC
TTTGACATCGCTGGGCCCTCGATCCGGGGCGCTNTGGTGCTTGGCTATGAGGGTTGGCTGGCTGGCTACCAGATGAATTT
TGAGACCTCGAAGTCCCGAGTGACCCA
Sequence Type mRNA
Unitrap ID UNI16414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52187802..52197525 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es