Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTB025
Clone ID YTB025
Vector pGT0Lxf
Project baygenomics

Sequence tag YTB025
Sequence
TGGCCCACTGTTGCACCACTGGCTCCAGACAGGTGACACCCTTCACCGAGTTCTGTGTTTGAGCCAGAGTGAGAGACACA
TTCTTCTTTGCAGGAAACCAGCTTTGGTCTCCACAGTAGAAGGTGGCCAGGACCCCAAGAGCCTCTCAGAAATCCAGCCC
GGAATGTTGCTCATTGGTTTTGTGAAGTGCATCAAGGAGTATGGCGTGTTCGTCCAGTTCCCCTCAGGTCTCAGTGGACT
GTCCCCCAAAACTATCATGAGTGACAAGTTCGTAACCACTCCAAGTGAACACTTTGTGGAGGGTCAGACAGTCGTTGCTA
AGGTGACCAATGTGGATGAATCGAAGCAGAGGATGCTGCTGTCTCTGCGGCTGTCAGACTGCAGTCTGGGGGATTCGGCC
AGCACCAGCTTCCTCCTCCTGTGCCAGTGCCTGGAAGAGCTGCAGGGCATTCGCAGCCTCATGAGCAACCAAGACTCTGT
ATTGATCCAGACACTTGCTGACATGACCCCGGGGATGGTCCTTGATTCCGTGGTCCATGAGGTGTTAGAAGATGGTTCAG
TGGTGTTCAGTAGTGATCCTGTGCCTGACCTGGTCTTGAGAGCCAGCAGATACCACCGGG
Sequence Type mRNA
Unitrap ID UNI5292

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47182157..47185597 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025047 (Pdcd11) NM_011053 programmed cell death 11 Gene [Source:MGI Symbol;Acc:MGI:1341788]

 
Come back to gene ENSMUSG00000025047


For any suggestions or comments, please send an email to unitrap@crg.es