Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTB026
Clone ID YTB026
Vector pGT0Lxf
Project baygenomics

Sequence tag YTB026
Sequence
GGCACACCTCGGGCTTTACCATGGAGGACTACCTGCAGGACTGTCGAGCCGCTTTGCAGGATTCCAGGCCTCTACATGTC
GTGCTGGGAAATGAAGCCTGCGACTTAGACTCCATGGTGTCTGCTCTCGCCTTGGCCTTCTACCTAACAAAGACGTCTGA
AGCTGAAGACATCTTTATACCAGTTTTAAATATAAAGCGTTCTGAGCTTCCTCTGCGAGGGGACAATGTCTTCTTTCTCC
AGGAGGTTAAGATTCCAGAGCCAGCCCTGATCTTTCCGGGACGAGTATTGACCTCTCTATGCCCTGCATCCAGGCTGGCC
AGCTCACCCTCATCCTTGTTGACCACCATATTTTACCCAAAAGCGATGCAGCTCTGGAGGAGGCCGTAGCAGAGGTGCTG
GACCACCGACCAATTGAGCAGAAATACTGTCCTCCCTGTCACGTTTCAGTTGAGCTGGTGGGGTCCTGTGCCACCCTGGT
GACAGAGAGAATCCTGCAGGGGGCACCAGAGACCTTGGACAGACAAACTGCAGCCCTACTGCATGGAACCATCATCCTGG
ACTGTGTCAACATGGATACCAACATTGGGAAGGCAACCCCAAAGGACAGCAAATATGTGGAAGAACTGGAAGCCCTTTTC
CCAGATCTGCCCAAAAGAAAGGACATATTTGATTCCCTGCAGAAGGCCAAGTTTGACGTCT
Sequence Type mRNA
Unitrap ID UNI4992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95066136..95085565 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]

 
Come back to gene ENSMUSG00000015711


For any suggestions or comments, please send an email to unitrap@crg.es