Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST261827
Clone ID OST261827
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST261827
Sequence
GACTGAGCAATCCAGCAGCAACTTCATTGTTGTCATACACCCAGGTTCAACAACTCTAAGACTTGGCCGAGCCACAGATA
CACTTCCGGTCAGTGTTCCTCACGTCATTGCACGAAGACACAAACAACAAGGGCAGCCCCTGTACAAGGACAACTTGGCT
CCTAAGGGAAGGACTAAATAAACCTGAAAGTAATGAACAAAGACAAAATGGCCTTAAAATGGTGGACCAGGCAATATGGT
CTAAAAAGATGTCAAACGGTACAAGGCGGATCCCTGTGTCACCAGAACAGACACGCTCCTACAACAAGCAGATGCGACCT
GCCATTCTAGATCACTGTTCTGGAAACAAATGGACAAACACATCTCAGCAGCCTGAGTATTTGGTAGGAGAAGAGGCCTT
GTATGTTAACCCCCTGGACTGTTACAACATTCACTGGCCTATCAGAAGGGGTCAGCTGAACATCCACCCAGGCCCCGGAG
GCTCCCTCACAGCTGTTCTGGCAGACATTGAAGTGATCTGGTCTCATGCAAAACC
Sequence Type mRNA
Unitrap ID UNI23374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 30795787..30799601 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015971 (Actr8) NM_027493 ARP8 actin-related protein 8 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1860775]

 
Come back to gene ENSMUSG00000015971


For any suggestions or comments, please send an email to unitrap@crg.es