Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTB029
Clone ID YTB029
Vector pGT0Lxf
Project baygenomics

Sequence tag YTB029
Sequence
ATCAAGTTTCATGCAGGCTCTTGGGGAAGCTGGTGCTGCTGCTGCTGTGTGATTACCGCGGACAGACCTTGGGACCGAGG
CCGGCGCTGGCAGCTGGAGATGGCGGACACACCGTCAGTGTATGAAACCAGATTTGAGGTGGCCGTGAAGGTGATCCAGA
GTTTGCCGAAAAATGGATCATTCCAACCAACAAATGAAATGATGCTTAAGTTCTATAGCTTCTACAAACAGGCAACTGAA
GGACCCTGTAAACTTTCACGGCCTGGATTCTGGGATCCTATTGGAAGATATAAATGGGATGCTTGGAGTTCACTGGGTGA
TATGACTAAAGAAGAAGCCATGATTGCATATGTTGAAGAAATGAAAAAGATTATTGAAACCATGCCCATGACTGAGAAAG
TGGAAGAGTTGCTGCATGTTATAGGTCCATTTTACGAGATTGTAGAAGACAAAAAGAGCAGCAAGAGTTCTGACTTGACC
T
Sequence Type mRNA
Unitrap ID UNI5293

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22924969..22935970 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026781 (Acbd5) NP_083069 acyl-Coenzyme A binding domain containing 5 Gene [Source:MGI (curated);Acc:Acbd5-002]

 
Come back to gene ENSMUSG00000026781


For any suggestions or comments, please send an email to unitrap@crg.es