Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTB048
Clone ID YTB048
Vector pGT0Lxf
Project baygenomics

Sequence tag YTB048
Sequence
AGGGCATGGACGTGGACTTGGATCCGGAGCTCATGCAGAAGTTCAGCTGCCTGGGCACCACAGACAAGGACGTGCTCATC
TCCGAGTTCCAGCGGCTACTCGGCTTCCAGCTCAACCCGGCCGGCTGCGCCTTCTTCCTGGACATGACCAACTGGAACTT
ACAAGCAGCGATTGGCGCCTATTATGACTTCGAGAGCCCAAATATCAGTGTGCCCTCCATGTCCTTTGTTGAAGATGTCA
CCATAGGAGAAGGGGAGTCAATACCCCCTGATACCCAGTTCATAAAAACTTGGCGGATACAGAATTCTGGAGCAGAGGCC
TGGCCTCCAGGGGTTTGTCTTAAATATGTCGGGGGAGACCAGTTTGGACATGTGAACATGGTGATGGTGAGATCACTAGA
GCCCCAAGAGATCGCAGACGTCAGCGTCCAGATGTGCAGTCCCAGCAGAGCAGGCATGTACCAGGGACAGTGGCGGATGT
GCACTGCTACTGGACTCTACTATGG
Sequence Type mRNA
Unitrap ID UNI5299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27923018..27957275 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]

 
Come back to gene ENSMUSG00000056692


For any suggestions or comments, please send an email to unitrap@crg.es