Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST261607
Clone ID OST261607
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST261607
Sequence
CAGTAAGTTCCTGCATAACANACACACCGGAAAATCTTACAGAGCCTGTGAGCCCAAGTGCCATGTCATTATGGANTGGA
ACATGCTACAGTGTGNCCNGACCTCTTCCACAAAGGGAGCATCANGATAACTTGTAACAGTNTTTCCATGANACNCTTTG
GAGGGTNCTNAGGGGTGACTCCTTTTGNAGGAGCGTCTTCCTCATTCTCAGTGGTAGTCAAGTTCATATCCTACAGGTTT
AACAGGTGGTGTCACTATATTTGTGGCCTTGTATGATTATGAAGCTAGAACTACAGAAGACCTTTCCTTTAAGAAGGGTG
AACGATTTCAAATAATTAACAATACGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI14472

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32942741..32947484 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]

 
Come back to gene ENSMUSG00000014932


For any suggestions or comments, please send an email to unitrap@crg.es