Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST261581
Clone ID OST261581
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST261581
Sequence
GACTGAGGAGTCTTGGTCCTTGGTGCTGGTCTCCTCTACTCACTCCGATCTGTGCGGTCTGTCATGCTCCTTGCAGGAGG
GCAGCAGGTGACATTGACCACCTATGCCCCCTTTGGCTTGGGTACCTGTTTCACAGTTCCCTTGAACCAGATTTCCTGCA
TGGCTCACAGAGGTGAAGTTCCTGCTATGCTGCCTCTGAAAGTCAAAGGCCGGCGCTTCTACTTCCTTTTGGACAAAGCT
GGACACTTTCCCAACACTCAACTCTTTGATAACACTGTGGGTGCCTACCGGAGCCTGTGAAAAATGGCTTACCCTTCTCA
GACGATGCAAAACCCTTAGGGATGAGGAGACTACCAGGACAATAAAAAGGTGCCCAGAATTCACTAACAGCCAATAAATC
TCTTCCAAAAGGCTTGA
Sequence Type mRNA
Unitrap ID UNI23383

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8846536..8846947 412
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075043 (0610006I08Rik) NM_025791 RIKEN cDNA 0610006I08 gene Gene [Source:MGI Symbol;Acc:MGI:1914086]

 
Come back to gene ENSMUSG00000075043


For any suggestions or comments, please send an email to unitrap@crg.es