Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST261549
Clone ID OST261549
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST261549
Sequence
ACTGAGATTTCAGATTTTGCAGCCTAAGGACATTTTCCAGGGGAGACTGCCAGTGCAGCCACCTTGGCAACCAAGATCCT
GATCCAGAGCCACATAGCCACAGACTGGAGTACTGGTGGGCCACAGTCCTCAAATACCTTCTCAAGGCAGGTTGTAAAAG
TTAACATGAACAAACATACGGCAAAGCTTCAGGAGAAAGAAAGACTGTTTATGTCCCAGAGGCCAGCCGTCCACATCAGT
TGGCAGACAGATGAAGAAGGAGTCCGCACTGGAAAGTGTAGCTTCCCAGTTAAGTACCTCGGCCACTGTACTAAGTTGAT
GAGTCAAGAGGAATGCACATNTGTGAAGATGCCGTATAGAGATTGAAAGCTGTATGTATTTGGTGGNTGCTGGTCCTGAN
CTGTGTTCTGTCAGTAAACAGAAAGAGCA
Sequence Type mRNA
Unitrap ID UNI20670

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 85172814..85217764 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021224 (Numb) NM_010949 numb gene homolog (Drosophila) Gene [Source:MGI (curated);Acc:Numb-001]

 
Come back to gene ENSMUSG00000021224


For any suggestions or comments, please send an email to unitrap@crg.es