Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA390
Clone ID YTA390
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA390
Sequence
GAGCAGCAAGATGCTGCAGCACATTGACTACAGGATGAGGTGCATCCTGCAGGACGGCCGCATCTTCATCGGGACCTTCA
AAGCCTTTGACAAGCACATGAACTTGATCCTGTGTGACTGTGATGAGTTCAGGAAGATCAAGCCAAAGAACTCCAAACAA
GCAGAAAGGGAAGAGAAGCGAGTCCTTGGTCTGGTGTTGCTTCGAGGGGAGAACCTGGTCTCCATGACAGTAGAAGGACC
TCCTCCCAAAGATACTGGCATTGCCCGAGTGCCACTTGCTGGAGCTGCTGGGGGGCCAGGCATCGGCAGGGCTGCTGGCA
GAGGAATCCCGGCTGGTGTTCCTATGCCCCAGGCTCCTGCAGGACTTGCTGGGCCAGTCCGAGGTGTTGGAGGGCCATCC
CAACAGGTGATGACCCCACAAGGAAGAGGCACTGTTGCAGCTGCTGCCGCTGCAGCCACAGCCAGTATTGCAGGAGCCCC
AACTCAGTACCCACCTGGTCGTGGGGGTCCTCCTCCACCTATGGGCCGAGGAGCCCCTCCTCCAGGTATGATGGGCCCAC
CTCCTGGCATGCGGCCTCCCATGGGTCCCCCAATGGGGCTCCCTCCTGGCCGAGGAACTCCAATGGGCATGCCCCCTCCT
GGCATGCGGCCTCCTCCTCCAGGCATGCG
Sequence Type mRNA
Unitrap ID UNI5302

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 129998341..130002891 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027404 (Snrpb) NM_009225 small nuclear ribonucleoprotein B Gene [Source:MGI (curated);Acc:Snrpb-001]

 
Come back to gene ENSMUSG00000027404


For any suggestions or comments, please send an email to unitrap@crg.es