Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST261407
Clone ID OST261407
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST261407
Sequence
GTGACTGGTTCAGTGGCTGAGCTCAAGTATGCCGTTGGTGAAAAGAAACATCGACCCTCGGCACTTGTGCCACACAGCAC
TGCCCAGGGGCATTAAGAACGAACTGGAATGTGTAACCAACATTTNCCTGGCAAATATAATTAGACAACTGAGTAGCCTA
AGTAAGTATCGCNAGAAGACATATTTGGAGAATTATTCAATGAAGCACACAGTTTTTCCTTCAGAGNTANCCTCGNTGCA
TGAGCGCGTNGACCGATTGTNTGTTAGTGTCACACAGNTTGATCCTAANGAGGAANAACGTTNGNNNCCACNTTTCTGGA
TTTNCCTTTACATTGNATCAACACANCCGAGATNAATAGTGTTCCCCAATAATA
Sequence Type mRNA
Unitrap ID UNI20643

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40640054..40646497 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019831 (Wasf1) NM_031877 WASP family 1 Gene [Source:MGI (curated);Acc:Wasf1-001]

 
Come back to gene ENSMUSG00000019831


For any suggestions or comments, please send an email to unitrap@crg.es