Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST261281
Clone ID OST261281
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST261281
Sequence
CTGAGAAGAAAATGACAGAGTGTTTGGAAGATTATTACTTTTGGAAGTCCTGCTAATATCCATTTCCTAAGAGATAGTTG
ACCAACATTGACTCTGGCATGGCGCAAAACAGTCCACAGCTTGATATTCAGGTTCTCCATGATCTTCGACAACGTTTTCC
TGAAATTCCAGAGGGTGTGGTATCCCAGTGCATGTTACAGAATAACAACAATCTAGAAGCCTGTTGTCGAGCCCTTTCCC
AGGAGAGCAGCAAATACTTGTATATGGAATACCATAGTCCAGAAGACAATAGAATGAATAGAAATCGCCTTTTGCATATT
AATTTGGGTATTCATTCTCCTAGTAGCTACCACCCAGGAGATGGAGCTCACCTTAATGGTGGTCGGACACTGGTACATAG
CTCAAGTGATGGACATATTGATCCTCAGCATACAGCAGGCAAACAGCTGATATGTTTAGTTCAGGAACCACACTCTCATG
Sequence Type mRNA
Unitrap ID UNI23390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82854727..82859584 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035476 (Map3k7ip3) NM_025729 mitogen-activated protein kinase kinase kinase 7 interacting protein 3 Gene [Source:MGI (curated);Acc:Map3k7ip3-001]

 
Come back to gene ENSMUSG00000035476


For any suggestions or comments, please send an email to unitrap@crg.es