Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST261206
Clone ID OST261206
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST261206
Sequence
GACTGAGGAAGATGCTCCAAGTACTTCCTTGAGTTCTTCGATGCACGGGAATGGAGTATTAAATTCCAGGGATGCAGCAA
GGCACACTGGCTGGAGCAAAACGCTACAAGTACCTCAGAAGGCTCTTTCGATTTCGGCAGATGGACTTTGAGTTTGCTGC
ATGGCAGATGCTCTACCTGTTTACCTCTCCTCAGAGGGTTTATAGAAACTTTCACTACCGGAAGCAAACAAAGGACCAGT
GGGCCAGAGATGACCCTGCCTTCTTAGTCCTCTTAAGTATCTGGCTCTGTGTGTCCACCATAGGATTCGGCTTTGTGCTG
GACATGGGATTTTTTGAGACAATAAAGCTGCTGCTGTGGGTTGTGTTTATAGATTGTGTGGGTGTTGGCCTTCTGATCTC
AACGTTAATGTGGTTCGTCTCCAACAAGTACCTGGTGAAACGCCAGAGCAGGGACTATGACGTGGAG
Sequence Type mRNA
Unitrap ID UNI23393

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 37488136..37494061 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026111 (Unc50) NM_026123 unc-50 homolog (C. elegans) Gene [Source:MGI (curated);Acc:Unc50-001]

 
Come back to gene ENSMUSG00000026111


For any suggestions or comments, please send an email to unitrap@crg.es