Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST261123
Clone ID OST261123
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST261123
Sequence
ACTGAGCTAGCAGCACAACATACCCTGTGGTTGTGAAGATGGGCCACGCACATTCTGGGATGGGCAAGGTCAAGGTAGAC
AACCAACATGACTTCCAGGATATTGCAAGTGTTGTGANACTGACATAANACATATGCCACNTGCATGAGCCCTNCATTGA
TGCTAAATATGATGTGCGTGTCCAGAAGATTGGGCAGAACTACAAGGCCTACATGAGGACATCAGTGTCGGGTAACTGGA
AGACCAATACAGGTTCTGCTATGCTTGAGCAGATTGCCATGTCTGACAGGTACAAGTTGTGGGTAGACACGTGCTCAGAG
ATTTTTGGGGGACTTGACATCTGCGCAGTGGAAGCGCTGCATGGCAAGGACGGAAGGGATCACATTATTGAGGTGGTGGG
CTCCTCCATGCCACTCATTGGTGATCACCAGGATGAAGACAAGCAGCTAATCGTGGAACTTGTGGTCAACAAGATGACTC
AGGCTCTGCCTCGGCAGCCGCAGCGGGATGCTTCCCCGGT
Sequence Type mRNA
Unitrap ID UNI23397

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20440732..20443036 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037217 (Syn1) NP_038708 synapsin I Gene [Source:MGI (curated);Acc:Syn1-001]

 
Come back to gene ENSMUSG00000037217


For any suggestions or comments, please send an email to unitrap@crg.es