Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone SYA280
Clone ID SYA280
Vector pGT0Lxf
Project baygenomics

Sequence tag SYA280
Sequence
GAGGCGGAGGATCCTTCCTGTGTGGAAGCCGCAGATCCCGGTGAGCCCTCTCACCTGGCGCTCTCTCCATCCTCGGCGCG
ATAACCATGGCAGCAGGCTGCGAGGGCATCGCGCCCCCGACCCTGGGCGAGAGAACTGTGGGGGAGGAAGGTGAACCTGT
CAAACCTTTTACACCAGAGAAAGCGAAAGAGATTATAATGTCTTTACAGCAGCCTGCAATCTTCTGTAACATGGTTTTCG
ATTGGCCATCACGACACTGGACTGCGAAACACCTTTCGAAGGTCTTGGAGGGCAAGCAGATACGGTTCAGAATGGGCCTG
AGAGGCACAGGCA
Sequence Type mRNA
Unitrap ID UNI5309

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35770476..35787458 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022849 (Hspbap1) NM_175111 Hspb associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913917]

 
Come back to gene ENSMUSG00000022849


For any suggestions or comments, please send an email to unitrap@crg.es